Электронная библиотека диссертаций и авторефератов России
dslib.net
Библиотека диссертаций
Навигация
Каталог диссертаций России
Англоязычные диссертации
Диссертации бесплатно
Предстоящие защиты
Рецензии на автореферат
Отчисления авторам
Мой кабинет
Заказы: забрать, оплатить
Мой личный счет
Мой профиль
Мой авторский профиль
Подписки на рассылки



расширенный поиск

Альфа-синуклеин крови как белковый маркер болезни Паркинсона Андоскин Павел Александрович

Диссертация - 480 руб., доставка 10 минут, круглосуточно, без выходных и праздников

Автореферат - бесплатно, доставка 10 минут, круглосуточно, без выходных и праздников

Андоскин Павел Александрович. Альфа-синуклеин крови как белковый маркер болезни Паркинсона: диссертация ... кандидата Биологических наук: 03.01.04 / Андоскин Павел Александрович;[Место защиты: Институт экспериментальной медицины].- Санкт-Петербург, 2016.- 126 с.

Содержание к диссертации

Введение

ГЛАВА 1. Обзор литературы 12

1.1. Клинические и патогенетические характеристики БП 12

1.1.1. История изучения заболевания 12

1.1.2. Симптоматика, распространенность 13

1.1.3. Диагностика БП 16

1.1.4. Экзогенные факторы риска 20

1.2. Наследственные основы БП 24

1.2.1. Моногенные формы БП 24

1.2.2. Аутосомно-доминантная форма БП, обусловленная мутациями в гене SNCA 27

1.2.3. Мутации в гене GBA - фактор высокого риска развития БП 29

1.2.4. Генетические факторы риска - результаты GWAS исследований 31

1.3. Альфа-синуклеин и БП 35

1.3.1. Структура и свойства альфа-синуклеина 35

1.3.2. Функции альфа-синуклеина 37

1.3.3. Химические модификации альфа-синуклеина 39

1.3.4. Агрегация альфа-синуклеина и нейродегенерация 40

1.3.5. Альфа-синуклеин крови и спинномозговой жидкости 42

1.3.6. Альфа-синуклеин тканей периферической нервной системы как возможный маркер БП 45

1.4. Заключение 49

ГЛАВА 2. Материалы и методы 51

2.1. Характеристика обследованных групп 51

2.2. Выделение ДНК из периферической крови человека 53

2.3. Идентификация полиморфного варианта и мутаций в гене GBA

2.3.1. Идентификация полиморфного варианта G1093A (E326K) гена GBA 54

2.3.2. Идентификация мутации A1226G (N370S) в гене GBA 56

2.3.3. Идентификация мутации T1448C (L444P) в гене GBA

2.4. Идентификация полиморфных вариантов rs356219 и rs356165 гена SNCA 59

2.5. Выделение однородной фракции CD45+ клеток крови 62

2.6. Оценка уровня мРНК гена SNCA 63

2.7. Оценка уровня общего и олигомерного альфа-синуклеина 65

2.8. Оценка уровня дофамина в плазме крови 67

2.9. Оценка уровня гемоглобина в плазме крови 67

2.10. Статистическая обработка результатов 67

ГЛАВА 3. Результаты и обсуждение 70

3.1. Скрининг вариантов rs356219 (G/A) и rs356165 (G/A) гена SNCA в группе пациентов с БП и в контрольной группе 70

3.2. Выявление GBA-ассоциированной БП 73

3.3. Оценка уровня общего и олигомерного альфа-синуклеина в плазме крови 77

3.4. Оценка уровня олигомерного альфа-синуклеина в плазме крови у пациентов с GBA-ассоциированной БП 82

3.5. Оценка уровня мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови 85 3.6. Оценка влияния полиморфных вариантов rs356219 (A/G) и rs356165 (A/G) гена SNCA на уровень мРНК SNCA и белка альфа-синуклеина в CD45+ клетках крови 89

3.7. Оценка корреляции уровня дофамина плазмы крови с уровнем мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках периферической крови 94

Заключение 97

Выводы 99

Список сокращений 100

Список литературы 101

Введение к работе

Актуальность проблемы. Болезнь Паркинсона (БП) – второе по частоте нейродегенеративное заболевание человека после болезни Альцгеймера. В большинстве развитых стран в возрасте старше 65 лет БП страдает до 2% населения. Около 10% пациентов имеют семейную форму БП. Описаны редкие моногенные формы заболевания, однако в большинстве случаев заболевание носит спорадический характер (Zhu et al., 2015).

Наиболее значимым фактором риска развития БП являются мутации в гене глюкоцереброзидазы (GBA), повышающие риск развития заболевания в 5-6 раз во всех популяциях (Sidransky et al., 2012). Развитие симптомокомплекса заболевания (тремор, ригидность мышц, брадикинезия, постуральная нестабильность) как при наследственных, так и при спорадических формах БП, коррелирует с гибелью дофаминергических нейронов черной субстанции (ЧС) головного мозга.

Предполагается, что в основе нейродегенерации при БП лежит нейротоксическое действие олигомеров небольшого пресинаптического белка – альфа-синуклеина (SNCA), однако механизм нейродегенерации при БП остается неясным (Eller, Williams, 2011). По этой причине не существует лабораторных диагностических тестов БП и доля случаев неправильной постановки диагноза достигает 25%. Диагноз ставится на основании клинического осмотра невролога в то время, когда сохранными остаются около 20% дофаминергических нейронов ЧС, что затрудняет разработку эффективной нейропротекторной терапии. В настоящее время не существует лекарственных средств, способных предотвратить или замедлить процесс нейродегенерации при БП.

Скрининг генетических факторов риска развития БП (в частности
мутаций в гене GBA) позволяет в ряде случаев выделить группы высокого
риска развития БП. Однако даже в этом случае невозможно говорить о сроке
манифестации заболевания. Необходимость разработки подходов,

направленных на раннее выявление БП, а также её дифференциальную диагностику не вызывает сомнений.

Степень научной разработанности темы. В настоящее время
ключевым патологическим процессом, лежащим в основе развития БП
рассматривается агрегация белка альфа-синуклеина. Описаны моногенные
формы БП, обусловленные как точковыми мутациями в гене SNCA, так и
мультипликацией нормальной последовательности гена. Ряд данных
указывает на то, что повышение концентрации альфа-синуклеина является
достаточным фактором для формирования его нейротоксичных олигомерных
форм. Исследование пациентов с БП, связанной с трипликацией гена SNCA,
приводящей к увеличению концентрации белка в клетках мозга и крови
показали, что такое накопление альфа-синуклеина является достаточным для
развития заболевания. Повышенная экспрессия гена SNCA в

дофаминергических нейронах in vitro и in vivo сопровождается формированием олигомерных структур альфа-синуклеина и гибелью нейронов. Модель паркинсонизма на животных, полученная путем гиперэкспрессии гена SNCA человека, отражает основные симптоматические и патоморфологические проявления БП – возрастное нарушение моторики, ассоциированное с гибелью дофаминергических нейронов мозга.

В настоящее время высказывается предположение, что измерение уровня альфа-синуклеина периферических жидкостей и тканей может служить прогностическим маркером заболевания.

В данной работе впервые исследуется возможность использования оценки уровня альфа-синуклеина однородной фракции CD45+ клеток крови в качестве прогностического маркера БП, а также изучается влияние дофамина плазмы и однонуклеотидного полиморфизма (ОНП) в 3’-области гена SNCA на уровень мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках.

Цель исследования. Исследование ассоциации вариантов гена SNCA и уровня белка альфа-синуклеина крови с болезнью Паркинсона.

Задачи исследования:

  1. Оценить вклад вариантов rs356219 (A/G) и rs356165 (A/G) гена SNCA в риск развития БП в России.

  2. Оценить уровень мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови у пациентов, находящихся на ранних стадиях БП и не получающих терапию Л-ДОФА-содержащими препаратами, и в контрольной группе.

  3. Оценить уровни общего и олигомерного альфа-синуклеина в плазме крови у пациентов со спорадической БП, а также уровень олигомерного альфа-синуклеина в плазме крови у пациентов с GBA-ассоциированной БП и в контрольной группе.

  4. Оценить влияние вариантов rs356219 (A/G) и rs356165 (A/G) гена SNCA на уровень мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови у пациентов с БП и в контрольной группе.

  5. Оценить корреляцию уровня дофамина в плазме крови с уровнем мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови у пациентов с БП и в контрольной группе.

Научная новизна:

  1. Впервые в России показана ассоциация носительства варианта G (rs356219 (A/G) и rs356165 (A/G)) гена SNCA с риском развития БП.

  2. Впервые показана ассоциация варианта G (rs356219 (A/G) и rs356165 (A/G)) гена SNCA c повышением уровня мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови в контрольной группе.

3. Впервые показано повышение уровня олигомерных форм альфа-синуклеина в плазме крови у пациентов с GBA-ассоциированной БП по сравнению с контрольной группой и группой пациентов со спорадической БП. Также было показано, что уровень общего альфа-синуклеина однородной фракции CD45+ клеток периферической крови не может рассматриваться в качестве маркера БП. 4. Впервые показана корреляция уровня дофамина в плазме крови с уровнем альфа-синуклеина в CD45+ клетках крови у лиц контрольной группы и уровнем мРНК гена SNCA у пациентов с БП.

Теоретическая и практическая значимость работы. Результаты, полученные в ходе выполнения данного исследования, представляют интерес для понимания биохимических и молекулярно-генетических основ патогенеза БП.

Показано, что носительство варианта G (rs356219 (A/G) и rs356165 (A/G)) гена SNCA ассоциировано с повышенным риском развития БП. Также у носителей вышеуказанного варианта гена показано повышение уровня мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках у лиц контрольной группы.

Повышенный уровень олигомеров альфа-синуклеина в плазме выявлен у пациентов с GBA-ассоциированной БП.

Полученные данные могут быть полезны для выявления групп риска БП, а также для разработки подходов к ранней диагностике GBA-ассоциированной БП.

Методология и методы исследования. Исследование уровней
различных форм белка альфа-синуклеина, мРНК гена SNCA, дофамина,
гемоглобина, а также генотипирование были произведены с использованием
периферической крови, полученной от пациентов с БП, а также от лиц
контрольной группы, не имеющих неврологических расстройств.

Вышеперечисленные показатели были исследованы с использованием биохимических, иммунохимических и молекулярно-генетических методов. Изучены ассоциации вариантов генов с риском развития БП, корреляции уровней изученных параметров друг с другом. Исследование проведено с исключением ряда факторов, влияние которых могло вносить значительные искажения в результаты исследования. Все эксперименты выполнены в строгом соответствии с требованиями инструкций производителей коммерческих наборов, а также в соответствии с ранее описанными в научной литературе методиками.

Основные положения, выносимые на защиту:

  1. Вариант G (rs356219 (A/G) и rs356165 (A/G)) гена SNCA повышает риск развития БП и ассоциирован с повышением уровня мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках периферической крови у лиц контрольной группы.

  2. При спорадической БП не наблюдается изменения уровней общего и олигомерного альфа-синуклеина в плазме крови, а также уровней мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках крови.

  3. Развитие GBA-ассоциированной БП характеризуется повышением уровня олигомерного альфа-синуклеина в плазме крови.

  4. Уровень дофамина в плазме крови коррелирует с уровнем альфа-синуклеина в CD45+ клетках периферической крови у лиц контрольной группы, а также с уровнем мРНК гена SNCA в CD45+ клетках у пациентов с БП.

Степень достоверности и апробация материалов исследования.

Степень достоверности и обоснованности положений, выносимых на защиту,
представленных в диссертации, обеспечена применением адекватных и
современных биохимических и молекулярно-генетических методов,

достаточным объемом исследованных выборок, а также корректной статистической обработкой полученных результатов исследований.

Предложенные к защите результаты были доложены на II и III Национальном конгрессе с международным участием по болезни Паркинсона и расстройствам движений, Москва, 2011, 2014; Российском конгрессе с международным участием «Молекулярные основы клинической медицины – возможное и реальное», Санкт-Петербург, 2012; Международной Пущинской школе-конференция молодых ученых, Пущино, 2013; Европейской конференции по генетике человека, Милан, 2014; I Конференции молодых ученых и специалистов ПИЯФ, Гатчина, 2014; Международной медико-биологической конференции молодых исследователей, посвященной двадцатилетию медицинского факультета СПбГУ, Санкт-Петербург, 2015; Российском конгрессе с международным участием «Молекулярные основы клинической медицины – возможное и реальное», Санкт-Петербург, 2015.

Публикации. Результаты диссертационного исследования отражены в 4 печатных работах соискателя, в том числе опубликованы в 4 статьях в рецензируемых научных журналах, рекомендованных ВАК РФ для публикации основных результатов диссертационных исследований.

Личный вклад автора. Наблюдение пациентов с БП, забор периферической крови производился сотрудниками ПСПбГМУ им. акад. И. П. Павлова, центра экстрапирамидных расстройств и нарушения движений клиники ФГБНУ ИЭМ. Выделение ДНК, мРНК выполнялось автором лично.

Сбор плазмы крови, выделение лимфоцитов и однородных CD45+ клеток
крови выполнялись автором лично. Генотипирование полиморфных
вариантов rs356219 (A/G) и rs356165 (A/G) гена SNCA, мутаций в гене GBA
выполнялось автором лично. Выделение мРНК и измерение относительного
уровня мРНК методом ПЦР в режиме реального времени выполнялись
автором лично. Совместно с научным руководителем Пчелиной С.Н.
проводилась оценка уровня общего белка в лизате клеток, оценка уровня
альфа-синуклеина, гемоглобина и дофамина крови методом

иммуноферментного анализа (ИФА). Полученные данные были подвержены статистической обработке автором лично. Выводы были сформулированы автором лично. Описание исследований, анализ и обсуждение результатов выполнены автором самостоятельно. Совместно с соавторами и научным руководителем обсуждались все материалы, освещенные в данном исследовании.

Структура и объем диссертации. Диссертация изложена на 126
страницах машинописного текста, содержит 11 таблиц, иллюстрирована 25
рисунками и состоит из следующих разделов: введения, обзора литературы,
материалов и методов исследования, результатов и обсуждения

исследования, заключения, выводов, списка сокращений и списка литературы, включающего 211 научный источник (19 – на русском языке и 192– на иностранном).

Основное содержание работы. Глава 1 содержит обзор современной литературы о клинических и патогенетических характеристиках БП, о её наследственных основах, а также характеризует белок альфа-синуклеин, рассматриваемый сегодня в качестве центрального звена патогенеза БП. Глава 2 описывает основные характеристики обследованных групп, а также материалы и методы исследования. В Главе 3 объединены результаты, полученные в рамках данного исследования, а также приводится их обсуждение. Далее приведены заключение, выводы, список сокращений и список литературы.

Диагностика БП

Болезнь Паркинсона (БП) – это распространенное хроническое нейродегенеративное заболевание (Левин, Федорова, 2006; Угрюмов, 2010). В качестве ключевого звена патогенеза БП рассматривается гибель специализированных дофаминергических нейронов нигростриатной системы мозга, приводящая к резкому снижению концентрации дофамина в полосатом теле, а также нарушение функционирования базальных ганглиев.

Первое упоминание о симптоматике заболевания можно найти в монографии Essay on the Shaking Palsy («Эссе о дрожательном параличе»), написанной Джеймсом Паркинсоном в 1817 году. Следует отметить исключительную точность описанных Паркинсоном основных симптомов заболеваний: тремор покоя, согбенность, шарканье при ходьбе, ретропульсия. Также Паркинсон указал на прогрессирующий характер заболевания, результатом которого является обездвиженность. Несколько десятилетий спустя Ж.-М. Шарко, изучавший психогенную сторону заболевания, предложил назвать данное заболевание болезнью Паркинсона. Большой вклад в развитие взглядов о патогенезе болезни Паркинсона внес российский невролог К.Н.Третьяков, которым были освещены морфологические характеристики болезни, при которой основная роль отводилась процессу гибели нейронов ЧС. Помимо этого, Третьяков обнаружил концентрические цитоплазматические включения в нейронах ЧС головного мозга, названные впоследствии тельцами Леви по имени впервые описавшего их ученого. После нейроморфологических работ К.Н.Третьякова и пандемии летаргического энцефалита первоначальные представления о психогенной природе заболевания сменились на дегенеративно-постэнцефалическую теорию БП (Пчелина, 2012).

Открытие роли дефицита дофамина в базальных ганглиях в патогенезе БП и возможности эффективного облегчения симптоматики БП благодаря использованию леводопы - предшественника дофамина явились началом современного этапа изучения БП. Открытие молекулярной основы наследственной формы БП, обусловленной мутациями в гене альфа-синуклеина (SNCA) в конце XX века явилось важнейшим прогрессом в изучении этиологии и патогенеза заболевания (Polymeropoulos et al., 1997).

Первые симптомы заболевания появляются тогда, когда количество дофаминергических нейронов снижено на 50% по сравнению с соответствующими по возрасту лицами контрольной группы и на 80% по сравнению с молодыми обследуемыми. Средний возраст начала развития симптоматической картины заболевания составляет 55 лет (Угрюмов, 2010).

На сегодняшний день к классическим симптомам БП относят: 1. Ригидность мышц (повышенный тонус скелетной мускулатуры по экстрапирамидному типу); 2. гипокинезия (снижение подвижности вплоть до полной обездвиженности (акинезия)); 3. тремор «покоя» (дрожание конечностей, головы и нижней челюсти); 4. постуральная нестабильность (нарушения позы). Начало развития клинической симптоматики БП, как правило (в 75% случаев), начинается с проявления дрожательного симптома. В ряде случаев для БП характерно развитие психических изменений, преимущественно эмоционально-мотивационных и когнитивных функций, вегетативных расстройств (по парасимпатическому типу): со стороны желудочно-кишечного тракта (запоры, диспепсии), сердечно-сосудистой системы (гипотония, брадикардия), кожных покровов (сальность, шелушение). Большинство авторов выделяют дрожательные, ригидные, смешанные и акинетические формы БП (Голубев и др., 2000).

Многочисленные наблюдения свидетельствуют о появлении определенных проявлений двигательного «неблагополучия» (таких как повышенная утомляемость, субклинические признаки нарушений моторной координации и т.п.) и ряда еще более ранних признаков недвигательных нарушений задолго до развернутой клинической картины БП (Иллариошкин, 2011).

Нейродегенеративный процесс при БП имеет нелинейный характер. Как показано в морфологических и прижизненных изотопно-нейровизуализационных исследованиях, для здоровых людей характерна постепенная и равномерная гибель нейронов ЧС со скоростью 4,7% за десятилетие, тогда как при БП за первые 10 лет болезни погибает примерно 45% нигральных дофамин-продуцирующих нейронов. Более того, основная гибель нейронов происходит за несколько лет до проявления клинических симптомов или в первые 2-3 года болезни (Gaig, Tolosa, 2009; Hawkes et al., 2010). Существование длительной, многолетней стадии «предболезни» у пациентов с БП в настоящее время не вызывает сомнений.

На сегодняшний день был выдвинут термин «синдром риска БП», который может быть подразделен на несколько последовательных стадий: 1. Префизиологическая стадия – наличие только определенной генетической предрасположенности к развитию БП, без каких-либо клинических признаков текущего нейродегенеративного процесса; 2. Преклиническая стадия – появление первых признаков нигростриарного дефицита, без клинических признаков текущего нейродегенеративного процесса, выявляемых с помощью методов нейровизуализации; 3. Премоторная стадия – появление недвигательных симптомов БП; 4. Предиагностическая стадия - выявление определенных «мягких» неврологических симптомов, недостаточных для постановки диагноза БП. Следует отметить, что такая классификация латентной стадии нейродегенеративного процесса при БП не бесспорна, но в целом внимание к «предранней» диагностике БП является чрезвычайно важным (Иллариошкин, 2011).

Идентификация полиморфного варианта и мутаций в гене GBA

Критерием отбора пациентов служило сочетание хотя бы двух фенотипических проявлений, характерных для БП: гипокинезия, ригидность, тремор покоя, постуральная неустойчивость. Пациенты были обследованы в консультативно-диагностическом центре ПСПбГМУ им. акад. И.П.Павлова и в центре экстрапирамидных расстройств и нарушения движений клиники ФГБНУ ИЭМ. Всего в исследование вошло 480 пациентов с БП и 262 индивидуума контрольной группы. Для проведения идентификации мутаций в гене GBA у пациентов с БП с целью формирования однородной по этиологии группы пациентов были доступны образцы ДНК 480 пациентов с БП (у 300 из них было проведено генотипирование полиморфного варианта G1093A). В исследовании ОНП гена SNCA были использованы ДНК 260 пациентов с БП и 262 индивидуумов контрольной группы.

В исследование генетических вартантов гена SNCA вошло 260 пациентов с БП (средний возраст 63,8±9,8 лет, средний возраст начала заболевания 49±10,9 лет, 150 мужчин и 110 женщин).

Контрольная группа состояла из 262 индивидуумов (средний возраст 67,7±8,8, 142 мужчины и 120 женщин), состоящих на учте в Санкт-Петербургском Городском Гериатрическом Центре. Все члены контрольной группы проходили обследование у невролога с целью исключения диагноза БП и других нейродегенеративных заболеваний. Данная выборка является случайной и принадлежит к тому же географическому региону, что и включенная в анализ группа лиц с БП. Включенная в исследование группа пациентов не отличалась от контрольной группы по полу и возрасту.

В ходе данного проекта был также создан банк плазмы крови и CD45+ клеток крови пациентов с БП (N=43, 12 мужчин, 31 женщина, средний возраст 60,0±7,0 лет) и лиц контрольной группы (N=39, 18 мужчин, 21 женщина, средний возраст 61,0±9,0 лет). Для оценки уровня белка альфа-синуклеина в группу пациентов с GBA-ассоциированной БП вошли 17 человек (10 пациентов были доступны для вызова и забора плазмы крови, 7 образцов плазмы крови были предоставлены Научным центром неврологии РАМН (г. Москва)). Средний возраст пациентов с GBA-ассоциированной БП составил 59,7±5,5 лет (10 мужчин, 7 женщин). Ряд пациентов с данной формой БП получал препараты Л-ДОФА-содержащими препараты.

Все пациенты, входящие в исследуемые группы со спорадической БП не получали терапию Л-ДОФА-содержащими препаратами, что исключает влияние повышенного уровня дофамина на уровень белка альфа-синуклеина, а также уровень мРНК гена SNCA в клетке. Все индивидуумы контрольной группы прошли осмотр невролога с целью исключения неврологических заболеваний.

Исследование было одобрено этическим комитетом соответствующих клинических учреждений и проводилось при получении информированного согласия. Характеристика групп, в которых проводились измерения биохимических параметров (уровни общего и олигомерного альфа-синуклеина в плазме крови, уровня мРНК гена SNCA, а также уровня общего альфа-синуклеина в CD45+ клетках крови) представлены в Таблице 4. Таблица 4 Характеристика обследованных групп Общий альфа-синуклеин в плазме Олигомерный альфа-синуклеин в плазме мРНК гена SNCA, общийальфа-синуклеин в CD45+клетках периферическойкрови БПN=19 КонтрольN=18 GBA- БПN=17 БПN=23 КонтрольN=27 БПN=43 КонтрольN=39 ср. возр. -63,0±9,3, 8 муж., 11 жен. ср. возр. -64,3±11,5, 8 муж., 10 жен. ср. возр. -60,8±11,1, 10 муж., 7 жен. ср. возр. -61,2±11,2, 9 муж., 14 жен. ср. возр. -59,8±10,8, 10 муж., 17 жен. ср. возр. -62,0±9,2, 17 муж., 26 жен. ср. возр. -61,2±9,0, 18 муж., 21 жен. 2.2. Выделение ДНК из периферической крови человека

Забор 10-15 мл периферической крови из локтевой вены у исследуемых осуществлялся в стерильные вакутейнеры, содержащие 100 мкл 0,5М ЭДТА (рН 8,0) в качестве антикоагулянта. Собранная кровь подвергалась замораживанию и хранению при температуре -20С.

Геномную ДНК выделяли из лейкоцитов периферической крови методом фенольно-хлороформной экстракции (Маниатис и др., 1984). Лизис клеток проводили описанным ранее методом (Lahiri et al, 1992): к 500 мл крови добавляли 500 мкл раствора для лизиса эритроцитов (29 мМ Tris-HCl рН 7,4, 10 мМ NaCl, 3 мМ MgCl2, 5% сахароза, 1% тритон Х100), инкубировали в течение 5 мин., осторожно перемешивая, затем центрифугировали 10 мин. при +9С, 4000 об/мин. Супернатант сливали и ресуспендировали осадок лейкоцитов в растворе для лизиса мембран (29 мМ Tris-HCl рН 7,4, 10 мМ NaCl, 1 мМ MgCl2, 0,25 М сахароза). Смесь центрифугировали при тех же условиях, супернатант сливали. К осадку добавляли 300 мкл раствора TNE (0,01 М Tris-HCl, 0,01 М NaCl, 0,01 М ЭДТА рН 8,0), 30 мкл 30% SDS и протеиназу К до конечной концентрации 100 мкг/мл. Смесь инкубировали в течение 2-3 часов при +50С для протеолиза. Получившийся в результате гомогенный раствор последовательно обрабатывали 300 мкл фенола, 300 мкл смеси фенол-хлороформ в соотношении 1:1, 300 мкл хлороформа. После каждой экстракции в течение 10 мин при аккуратном перемешивании смесь центрифугировали 10 мин. при +20С 4000 об/мин и отбирали водную фазу. По окончании экстракции к водной фазе добавляли 1/10 объема 3М ацетата натрия и 2 объема 96% этилового спирта. Осадок дважды промывали 70% этанолом и, высушив в термостате, растворяли в 100 мкл воды. Выход ДНК в результате такой очистки составлял 50-100 нг/мкл из 500 мкл цельной крови. 2.3. Идентификация полиморфного варианта и мутаций в гене GBA 2.3.1. Идентификация полиморфного варианта G1093A (E326K) гена GBA

Для идентификации полиморфного варианта G1093A, приводящего к аминокислотной замене E326K в гене GBA был разработан новый метод, основанный на проведении ПЦР и рестрикционного анализа. Праймеры были разработаны с помощью программы Primer Express: For 5 GTTGCATTCTTCCCGTCACC – 3 , Rev 5 -CTGGACAGGAAGGGCTTCTG-3 (Таблица 5). Амплификацию проводили в 15 мкл реакционной смеси, содержащей TaqMan Universal PCR Master Mix (Termoscientific) и 3-10 нг геномной ДНК. После первоначальной денатурации при 94С в течение 5 мин, 30 циклов амплификации проводили в следующем температурно-временном режиме: денатурация +92С – 30с, отжиг праймеров: +60С – 30с, синтез: +72С –30с. После завершения 30 циклов амплификации проводили заключительный синтез при +72С в течение 5 мин. В результате получали ПЦР-продукт размером 418 п.н. Для проведения рестрикционного анализа полученный ПЦР-продукт инкубировали в присутствии 0,5 ед. эндонуклеазы Alw26I (BsmAI) и соответствующего 1х буфера Tango производства «Fermentas» (10 mM Tris-HCl pH=8,5; 10 mM MgCl2; 100 mM KCl; 0,1 mg /ml BSA) при +37С в течение 24 часов. После рестрикции фрагменты ДНК подвергали электрофоретическому разделению в 6% ПААГ. Результаты визуализировали в УФ-свете после окрашивания бромистым этидием. Размер фрагментов ДНК после рестрикционного анализа в случае аллеля G составил 191 и 227 п.н. (Рисунок 10).

Выявление GBA-ассоциированной БП

Нами, как и в предыдущих исследованиях не показано различия уровня общего и олигомерного альфа-синуклеина в плазме крови между пациентами с БП и в контрольной группе (Hong et al., 2010; Shi et al., 2010; Foulds et al., 2011; Park et al., 2011). При этом следует отметить, что всего в одно из перечисленных выше исследований вошла группа пациентов, не получающих терапию Л-ДОФА-содержащими препаратами.

Рядом исследователей в последние годы изучалась возможность оценки уровня периферического альфа-синуклеина в качестве прогностического маркера БП. Однако до настоящего момента вопрос остается открытым. Исследования по сопоставлению уровня мономерного альфа-синуклеина лимфоцитов периферической крови, плазмы и СМЖ у пациентов с БП и в контрольной группе носят противоречивый характер (Таблица 2, п.1.3.5). Уровень альфа-синуклеина в различных фракциях клеток мог быть как повышен, так и понижен или не изменяться у пациентов с БП по сравнению с лицами контрольной группы. Так, отмечалось, что уровень альфа-синуклеина не имел статистически значимых отличий у пациентов с БП и у лиц контрольной группы (Brighina et al., 2010), аналогичные результаты были получены для альфа-синуклеина плазмы крови в группе пациентов с БП и в контрольной группе (Shi et al., 2010). Измерение уровня альфа-синуклеина в СМЖ также не продемонстрировало статистически значимых отличий между сравниваемыми группами (Aerts et al., 2012).

Большое внимание было уделено разработке методов оценки олигомерных форм альфа-синуклеина, т.к. показано, что именно эти формы белка обладают нейротоксическим эффектом (Winner et al., 2011). На сегодня исследования по изучению олигомерных форм альфа-синуклеина в периферических жидкостях человека остаются малочисленными. Так, сопоставление уровня олигомерного альфа-синуклеина в СМЖ пациентов с болезнью Паркинсона и у лиц контрольной группы выявило повышение уровня олигомерных форм у пациентов в четырех исследованиях (Tokuda et al., 2010; Bruggink et al., 2011; Park et al., 2011; Unterberger et al., 2014). В плазме крови уровень олигомерного альфа-синуклеина был оценен также в нескольких работах. El-Agnaf с соавторами (2006) сообщает о повышении уровня олигомерного альфа-синуклеина у пациентов с БП, в то время как в более поздних исследованиях различий не обнаружено (Foulds et al., 2011; Park et al., 2011). Необходимо подчеркнуть, что в первое исследование были включены пациенты с БП, принимающие Л-ДОФА-содержащие препараты, приводящие к повышению уровня дофамина в плазме крови, что может влиять на уровень альфа-синуклеина. В наше исследование, а также в исследование Park с соавторами, были включены пациенты с БП, не получавшие лечения Л-ДОФА содержащими препаратами.

Суммируя полученные результаты можно предположить, что использование уровня общего и олигомерного альфа-синуклеина в плазме крови не является перспективным направлением поиска биомаркера заболевания. Анализируя данные литературы, можно сделать вывод об увеличении уровня олигомерного альфа-синуклеина в СМЖ, что свидетельствует о потенциальной возможности рассмотрения данной формы альфа-синуклеина в качестве биомаркера БП, однако это не являлось предметом данного исследования.

В ходе данного исследования нами была проведена оценка уровня олигомерного альфа-синуклеина в плазме крови у пациентов с однородной по этиологии GBA-ассоциированной БП. Всего в группу вошли 17 пациентов. Медиана концентрации олигомерного альфа-синуклеина в группе пациентов с GBA-ассоциированной БП составила (медиана (мин., макс.) - 1,75 (0,48 - 1259,41)).

Было получено статистически значимое увеличение уровня олигомерного альфа-синуклеина в плазме у пациентов с GBA-ассоциированной БП по сравнению с лицами контрольной группы (p=0,002) и пациентами со спорадической БП (p=0,004) (Рисунок 20). В настоящее время существует ряд гипотез о том, каким образом мутации в гене GBA столь значительно влияют на риск развития БП, включая гипотезу «gain-of-function», предполагающую непосредственное конформационное взаимодействии мутантной молекулы GBA c альфа-синуклеином (Cullen et al., 2011). Существует несколько гипотез, объясняющих возможные механизмы олигомеризации альфа-синуклеина при снижении ферментативной активности GBA.

Во-первых, аккумуляция глюкоцереброзида, происходящая при снижении ферментативной активности GBA, может приводить к изменениям в липидном составе мембран, что может влиять на уровень несвязанного альфа-синуклеина в клетке, потому как около половины всего клеточного альфа-синуклеина связано с липидами мембран (McGlinchey et al., 2013).

Оценка корреляции уровня дофамина плазмы крови с уровнем мРНК гена SNCA и белка альфа-синуклеина в CD45+ клетках периферической крови

Как уже упоминалось выше, на мембране CD45+ клеток крови представлены рецепторы дофамина и дофаминовый транспортер, что позволяет предполагать возможное влияние дофамина на внутриклеточные процессы. Влияние дофамина на уровень мРНК гена SNCA и уровень альфа-синуклеина в клетках может быть объяснено несколькими механизмами.

Во-первых, ранее в исследованиях in vitro было показано влияние дофамина (в том числе и получаемого с приемом Л-ДОФА-содержащих препаратов) на уменьшение степени метилирования регуляторных областей гена альфа-синуклеина (SNCA), приводя к увеличению экспрессии гена (Matsumoto et al., 2010).

Следует также отметить, что ранее у пациентов с БП было показано увеличение концентрации дофамина в лимфоцитах и тромбоцитах периферической крови при пероральном введении Л-ДОФА-содержащих препаратов (Martignoni et al., 1999; Rajda et al., 2005). Во-вторых, нельзя исключить прямого влияния дофамина на уровень альфа-синуклеина. Известно, что увеличение концентрации дофамина может приводить к появлению модифицированных форм альфа-синуклеина, что может усиливать агрегацию белка и нарушать его деградацию в клетке (Fujiwara et al., 2002; Anderson et al., 2006). Так окисленные формы дофамина способны образовывать аддукты с альфа-синуклеином, приводя к усилению олигомеризации и стабилизации нейротоксичных протофибрилл альфа-синуклеина (Conway et al., 2001; da Luz et al., 2015). Следует отметить немаловажную роль дофамина в стимулировании секреции олигомеров альфа-синуклеина нейронами, способными инициировать олигомеризацию белка в других нейронах (Lee et al., 2011; Planchard et al., 2014).

В настоящем исследовании мы оценивали уровень общего альфа-синуклеина в CD45+ клетках периферической крови. Оценка уровня олигомерных форм альфа-синуклеина в данной клеточной фракции нами не проводилась. Однако наблюдаемая корреляция уровня дофамина с уровнем мРНК гена SNCA у пациентов с БП и уровнем белка альфа-синуклеина у лиц контрольной группы согласуется с результатами исследований in vitro о влиянии дофамина на уровень экспрессии гена SNCA (Matsumoto et al., 2010). Следует отметить, однако, что нельзя исключать и обратного влияния альфа-синуклеина на дофамин по той причине, что альфа-синуклеин является ингибитором ключевого фермента синтеза дофамина – тирозингидроксилазы (Perez et al., 2002).

Обобщая полученные данные необходимо подчеркнуть важное значение наблюдаемой корреляции, связывающей дофамин и альфа-синуклеин. Наличие этой связи может способствовать пониманию молекулярных механизмов БП и объяснению селективной гибели дофаминергических нейронов, наблюдаемой при БП.

Нами исследована возможность использования оценки уровня альфа синуклеина плазмы крови, а также однородной фракции CD45+ клеток крови в качестве прогностического маркера БП. Проведенное исследование показало, что альфа –синуклеин периферической крови не может быть использован в качестве маркера БП. В ходе эксперимента нами был исключен фактор гемолиза, обследованы пациенты с БП, находящиеся на ранней стадии заболевания, не получавшие терапию Л-ДОФА-содержащими препаратами. Можно предположить, что на уровень альфа-синуклеина плазмы и мононуклеаров крови влияют не только генетические факторы, такие как, например, включенные в настоящее исследование локализованные в 3 -области гена SNCA полиморфные варианты, но также и уровень дофамина плазмы крови, этиология заболевания.

В данном исследовании нами впервые было показано, что GBA-ассоциированная БП характеризуется повышенным уровнем олигомерных форм альфа-синуклеина в плазме крови. Для дальнейшего исследования механизма развития GBA-ассоциированной БП целесообразно провести исследования корреляции активности фермента GBA у гетерозиготных носителей мутаций в гене GBA с уровнем олигомерных форм альфа-синуклеина у пациентов с диагнозом БП и у лиц без неврологических расстройств. Необходимо также проводить дальнейшие изучение клинических особенностей GBA ассоциированной формы БП, и осуществлять поиск факторов модифицирующих проявление заболевания у носителей мутаций. Подобные исследования необходимы для проведения медико-генетического консультирования пациентов с мутациями в гене GBA, для разработки походов к лечению заболевания и поисков маркеров ответа на терапию.